pTW5126
(Plasmid
#129732)
-
Purposepolyhistidine replacement of EatA passenger DUF corresponding to amino acids E541 -Q617 of the native EatA protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD/myc-HisB
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 4047
- Total vector size (bp) 7943
-
Modifications to backbonenone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeatA-DUF::His8
-
SpeciesEscherichia coli, Enterotoxigenic
-
Insert Size (bp)3897
-
Mutationreplaces the domain of unknown function corresponding to amino acids E541 -Q617 of the native EatA protein with 8H followed by an in-frame XhoI induced scar of L549-E550 in the DUF deletion recombinant.
-
GenBank IDAY163491.2
- Promoter araBAD
-
Tag
/ Fusion Protein
- 9His tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGTGCTTTGGCAGGTTAAT
- 3′ sequencing primer none (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plate note: Plasmid contains V673A and E1051G mutations in eatA-DUF. These mutations are not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTW5126 was a gift from James Fleckenstein (Addgene plasmid # 129732 ; http://n2t.net/addgene:129732 ; RRID:Addgene_129732) -
For your References section:
Enterotoxigenic Escherichia coli degrades the host MUC2 mucin barrier to facilitate critical pathogen-enterocyte interactions in human small intestine. Sheikh A, Wangdi T, Vickers TJ, Aaron B, Palmer M, Miller MJ, Kim S, Herring C, Simoes R, Crainic JA, Gildersleeve JC, van der Post S, Hansson GC, Fleckenstein JM. Infect Immun. 2021 Nov 22:IAI0057221. doi: 10.1128/IAI.00572-21. 10.1128/IAI.00572-21 PubMed 34807735