pTW5126
(Plasmid #129732)

• Purpose: polyhistidine replacement of EatA passenger DUF corresponding to amino acids E541 -Q617 of the native EatA protein
• Depositing Lab: James Fleckenstein
• Publication: Sheikh et al Infect Immun. 2021 Nov 22:IAI0057221. doi: 10.1128/IAI.00572-21.

Backbone

• Vector backbone: pBAD/myc-HisB
• Backbone manufacturer: ThermoFisher Scientific
• Backbone size w/o insert (bp): 4047
• Total vector size (bp): 7943
• Modifications to backbone: none
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eatA-DUF::His8
• Species: Escherichia coli, Enterotoxigenic
• Insert Size (bp): 3897
• Mutation: replaces the domain of unknown function corresponding to amino acids E541 -Q617 of the native EatA protein with 8H followed by an in-frame XhoI induced scar of L549-E550 in the DUF deletion recombinant.
• GenBank ID: AY163491.2
• Promoter: araBAD
• Tag / Fusion Protein:
  • 9His tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATGTGCTTTGGCAGGTTAAT
• 3′ sequencing primer: none

Resource Information

• Supplemental Documents:
  • pTW5126.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plate note: Plasmid contains V673A and E1051G mutations in eatA-DUF. These mutations are not known to affect plasmid function.