ORF30-2xStrep pCDNA4
(Plasmid
#129743)
-
PurposeExpresses KSHV ORF30 with Cterm 2xStrep tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA4/TO
- Backbone size w/o insert (bp) 5168
- Total vector size (bp) 5384
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF30
-
SpeciesKaposi's sarcoma-associated herpesvirus (HHV-8)
-
Insert Size (bp)231
-
GenBank ID4961433
-
Entrez GeneORF30 (a.k.a. HHV8GK18_gp34)
- Promoter CMV
-
Tag
/ Fusion Protein
- 2xStrep Tag II (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ORF30-2xStrep pCDNA4 was a gift from Britt Glaunsinger (Addgene plasmid # 129743 ; http://n2t.net/addgene:129743 ; RRID:Addgene_129743) -
For your References section:
The interaction between ORF18 and ORF30 is required for late gene expression in Kaposi's sarcoma-associated herpesvirus. Castaneda AF, Glaunsinger BA. J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18. 10.1128/JVI.01488-18 PubMed 30305361