UL79(E48A_L49A)-3xFLAG pCDNA4
(Plasmid
#129759)
-
PurposeExpresses CMV UL79 (E48A_L49A) with Cterm 3xFLAG tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA4/TO
- Backbone size w/o insert (bp) 5153
- Total vector size (bp) 5993
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUL79
-
SpeciesHuman Cytomegalovirus (HHV-5)
-
Insert Size (bp)885
-
Mutationchanged Glutamic acid 48 to Alanine and Leucine 49 to Alanine
-
GenBank ID3077474
-
Entrez GeneUL79 (a.k.a. HHV5wtgp073)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UL79(E48A_L49A)-3xFLAG pCDNA4 was a gift from Britt Glaunsinger (Addgene plasmid # 129759 ; http://n2t.net/addgene:129759 ; RRID:Addgene_129759) -
For your References section:
The interaction between ORF18 and ORF30 is required for late gene expression in Kaposi's sarcoma-associated herpesvirus. Castaneda AF, Glaunsinger BA. J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18. 10.1128/JVI.01488-18 PubMed 30305361