Skip to main content
Addgene

ORF18(G214A)-3xFLAG pCDNA4
(Plasmid #129808)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129808 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone size w/o insert (bp) 5168
  • Total vector size (bp) 5928
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF18
  • Species
    Kaposi's sarcoma-associated herpesvirus (HHV-8)
  • Insert Size (bp)
    771
  • Mutation
    changed Glycine 214 to Alanine
  • Entrez Gene
    ORF18 (a.k.a. HHV8GK18_gp22)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ORF18(G214A)-3xFLAG pCDNA4 was a gift from Britt Glaunsinger (Addgene plasmid # 129808 ; http://n2t.net/addgene:129808 ; RRID:Addgene_129808)
  • For your References section:

    The interaction between ORF18 and ORF30 is required for late gene expression in Kaposi's sarcoma-associated herpesvirus. Castaneda AF, Glaunsinger BA. J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18. 10.1128/JVI.01488-18 PubMed 30305361