Skip to main content

pTK_BsmBI_LacZ_Cherry_Nanotag_106
(Plasmid #130547)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130547 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTK_BsmBI
  • Backbone size w/o insert (bp) 4670
  • Vector type
    Enhancer cloning nanotag reporter vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    LacZ
  • Insert Size (bp)
    276
  • Promoter thymidine kinase minimal promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer pTK forward CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer pTK reverse ATATTTCTTCCGGGGACACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTK_BsmBI_LacZ_Cherry_Nanotag_106 was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 130547 ; http://n2t.net/addgene:130547 ; RRID:Addgene_130547)
  • For your References section:

    Reconstruction of the Global Neural Crest Gene Regulatory Network In Vivo. Williams RM, Candido-Ferreira I, Repapi E, Gavriouchkina D, Senanayake U, Ling ITC, Telenius J, Taylor S, Hughes J, Sauka-Spengler T. Dev Cell. 2019 Oct 21;51(2):255-276.e7. doi: 10.1016/j.devcel.2019.10.003. 10.1016/j.devcel.2019.10.003 PubMed 31639368