pTK_Zfhx4_enh_12_Citrine
(Plasmid
#130597)
-
Purposeenhancer reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130597 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTK_BsmBI_Citrine
- Backbone size w/o insert (bp) 4670
-
Vector typeenhancer reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameZfhx4_enh_12
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)950
- Promoter thymidine kinase minimal promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer pTK forward CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer pTK reverse ATATTTCTTCCGGGGACACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK_Zfhx4_enh_12_Citrine was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 130597 ; http://n2t.net/addgene:130597 ; RRID:Addgene_130597) -
For your References section:
Reconstruction of the Global Neural Crest Gene Regulatory Network In Vivo. Williams RM, Candido-Ferreira I, Repapi E, Gavriouchkina D, Senanayake U, Ling ITC, Telenius J, Taylor S, Hughes J, Sauka-Spengler T. Dev Cell. 2019 Oct 21;51(2):255-276.e7. doi: 10.1016/j.devcel.2019.10.003. 10.1016/j.devcel.2019.10.003 PubMed 31639368