pUTKan-3xHA-GFP-TOM5
(Plasmid #130674)

• Purpose: Ubiquitously expresses 3xHA-GFP-TOM5 in the outer mitochondrial membrane of planta
• Depositing Lab: Andreas Weber
• Publication: Kuhnert et al Plant Physiol. 2020 Feb;182(2):692-706. doi: 10.1104/pp.19.00732. Epub 2019 Dec 9.

Backbone

• Vector backbone: pUTKan
• Backbone manufacturer: Karin Schumacher
• Backbone size w/o insert (bp): 10862
• Total vector size (bp): 11826
• Vector type: Plant Expression
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Translocase of outer mitochondrial membrane 5
• Alt name: TOM5
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 166
• Entrez Gene: TOM5 (a.k.a. AT5G08040, T22D6.2, mitochondrial import receptor subunit TOM5 homolog)
• Promoter: Ubiquitin10
• Tags / Fusion Proteins:
  • 3xHA (N terminal on insert)
  • sGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: CGATTTTCTGGGTTTGATCG
• 3′ sequencing primer: aagaccggcaacaggattc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/672972v1 for bioRxiv preprint.