pUTKan-3xHA-GFP-TOM5
(Plasmid
#130674)
-
PurposeUbiquitously expresses 3xHA-GFP-TOM5 in the outer mitochondrial membrane of planta
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130674 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUTKan
-
Backbone manufacturerKarin Schumacher
- Backbone size w/o insert (bp) 10862
- Total vector size (bp) 11826
-
Vector typePlant Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTranslocase of outer mitochondrial membrane 5
-
Alt nameTOM5
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)166
-
Entrez GeneTOM5 (a.k.a. AT5G08040, T22D6.2, mitochondrial import receptor subunit TOM5 homolog)
- Promoter Ubiquitin10
-
Tags
/ Fusion Proteins
- 3xHA (N terminal on insert)
- sGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer CGATTTTCTGGGTTTGATCG
- 3′ sequencing primer aagaccggcaacaggattc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/672972v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUTKan-3xHA-GFP-TOM5 was a gift from Andreas Weber (Addgene plasmid # 130674 ; http://n2t.net/addgene:130674 ; RRID:Addgene_130674) -
For your References section:
Rapid Single-Step Affinity Purification of HA-Tagged Plant Mitochondria. Kuhnert F, Stefanski A, Overbeck N, Drews L, Reichert AS, Stuhler K, Weber APM. Plant Physiol. 2020 Feb;182(2):692-706. doi: 10.1104/pp.19.00732. Epub 2019 Dec 9. 10.1104/pp.19.00732 PubMed 31818904