pAG471 Lyn11-iFAST
(Plasmid
#130817)
-
PurposeExpresses Lyn11-iFAST in mammalian cells (inner plasma membrane labeling)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 3954
- Total vector size (bp) 4413
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLyn11-iFAST
-
Alt nameLyn11-FAST2
-
Alt nameiFAST fused to lyn11 sequence for membrane anchoring
-
Alt nameFAST2 fused to lyn11 sequence for membrane anchoring
-
SpeciesSynthetic
-
Insert Size (bp)459
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG471 Lyn11-iFAST was a gift from Arnaud Gautier (Addgene plasmid # 130817 ; http://n2t.net/addgene:130817 ; RRID:Addgene_130817)