pAG497 mito-iFAST
(Plasmid
#130819)
-
PurposeExpresses mito-iFAST in mammalian cells (mitochondria labeling)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 3975
- Total vector size (bp) 4485
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemito-iFAST
-
Alt namemito-FAST2
-
Alt nameiFAST fused to a mitochondrial targeting sequence
-
Alt nameFAST2 fused to a mitochondrial targeting sequence
-
SpeciesH. sapiens (human)
-
Insert Size (bp)510
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG497 mito-iFAST was a gift from Arnaud Gautier (Addgene plasmid # 130819 ; http://n2t.net/addgene:130819 ; RRID:Addgene_130819)