Skip to main content

pHWBF06exp
(Plasmid #130831)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130831 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pH7WG2
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SUN2
  • Species
    Zea mays (maize)
  • Promoter CaMV 35S
  • Tag / Fusion Protein
    • mCherry-FLAG-HA (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGTGTCCAAGGGCGAGGA
  • 3′ sequencing primer TGCGGACTCTAGCATGGCCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHWBF06exp was a gift from Hank Bass (Addgene plasmid # 130831 ; http://n2t.net/addgene:130831 ; RRID:Addgene_130831)
  • For your References section:

    Identification and characterization of genes encoding the nuclear envelope LINC complex in the monocot species Zea mays. Gumber HK, McKenna JF, Estrada AL, Tolmie AF, Graumann K, Bass HW. J Cell Sci. 2019 Feb 11;132(3). pii: jcs.221390. doi: 10.1242/jcs.221390. 10.1242/jcs.221390 PubMed 30659121