MLKP2delKASH
(Plasmid
#130838)
-
PurposeExpression of plant LINC fluorescent fusion protein for cell biology
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepH7WG2
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMLKP2
-
SpeciesZea mays (maize)
-
MutationDeletion of KASH domain, addition of three alanine residues
- Promoter CaMV 35S
-
Tag
/ Fusion Protein
- eGFP-FLAG-HA (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGTCTCCAAGGGGGAGG
- 3′ sequencing primer TGCGGACTCTAGCATGGCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MLKP2delKASH was a gift from Hank Bass (Addgene plasmid # 130838 ; http://n2t.net/addgene:130838 ; RRID:Addgene_130838) -
For your References section:
Identification and characterization of genes encoding the nuclear envelope LINC complex in the monocot species Zea mays. Gumber HK, McKenna JF, Estrada AL, Tolmie AF, Graumann K, Bass HW. J Cell Sci. 2019 Feb 11;132(3). pii: jcs.221390. doi: 10.1242/jcs.221390. 10.1242/jcs.221390 PubMed 30659121