Skip to main content

MLKG1delKASH
(Plasmid #130842)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130842 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pH7WG2
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MLKG1
  • Species
    Zea mays (maize)
  • Mutation
    Deletion of KASH domain
  • Promoter CaMV 35S
  • Tag / Fusion Protein
    • eGFP-FLAG-HA (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGTCTCCAAGGGGGAGG
  • 3′ sequencing primer TGCGGACTCTAGCATGGCCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MLKG1delKASH was a gift from Hank Bass (Addgene plasmid # 130842 ; http://n2t.net/addgene:130842 ; RRID:Addgene_130842)
  • For your References section:

    Identification and characterization of genes encoding the nuclear envelope LINC complex in the monocot species Zea mays. Gumber HK, McKenna JF, Estrada AL, Tolmie AF, Graumann K, Bass HW. J Cell Sci. 2019 Feb 11;132(3). pii: jcs.221390. doi: 10.1242/jcs.221390. 10.1242/jcs.221390 PubMed 30659121