pFl Strep-Sumo-TEV human OAS1
              
              
                (Plasmid
                
                #130895)
              
            
            
            
          - 
            PurposeHuman oligoadenylate synthase 1 (OAS1) is used to label terminal ADP-riobos
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130895 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepFl
 - 
              Vector typeInsect Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameoligoadenylate synthase 1
 - 
                  Alt nameOAS1
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)1632
 - 
                        Entrez GeneOAS1 (a.k.a. E18/E16, IFI-4, IMD100, OIAS, OIASI)
 - Promoter ph
 - 
    
        Tag
        / Fusion Protein
    
- Strep_Sumo (N terminal on insert)
 
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer CCTATAAATATTCCGGATTATTC
 - 3′ sequencing primer CTACAAATGTGGTATGGCTG (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pFl Strep-Sumo-TEV human OAS1 was a gift from Leemor Joshua-Tor (Addgene plasmid # 130895 ; http://n2t.net/addgene:130895 ; RRID:Addgene_130895) - 
                
For your References section:
ELTA: Enzymatic Labeling of Terminal ADP-Ribose. Ando Y, Elkayam E, McPherson RL, Dasovich M, Cheng SJ, Voorneveld J, Filippov DV, Ong SE, Joshua-Tor L, Leung AKL. Mol Cell. 2019 Feb 21;73(4):845-856.e5. doi: 10.1016/j.molcel.2018.12.022. Epub 2019 Jan 31. 10.1016/j.molcel.2018.12.022 PubMed 30712989