Skip to main content

pcDNA4/TO-ORF66 200-429-2xStrep
(Plasmid #130955)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130955 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5119
  • Total vector size (bp) 5810
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF66
  • Species
    Kaposi's Sarcoma Associated Herpesvirus (HHV-8)
  • Insert Size (bp)
    691
  • Mutation
    ORF66 a.a. 200-429
  • Entrez Gene
    ORF66 (a.k.a. HHV8GK18_gp75)
  • Promoter CMV
  • Tag / Fusion Protein
    • 2xStrep (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4/TO-ORF66 200-429-2xStrep was a gift from Britt Glaunsinger (Addgene plasmid # 130955 ; http://n2t.net/addgene:130955 ; RRID:Addgene_130955)
  • For your References section:

    Conserved CxnC motifs in Kaposi's sarcoma-associated herpesvirus ORF66 are required for viral late gene expression and are essential for its interaction with ORF34. Didychuk AL, Castaneda AF, Kushnir LO, Huang CJ, Glaunsinger BA. J Virol. 2019 Oct 2. pii: JVI.01299-19. doi: 10.1128/JVI.01299-19. 10.1128/JVI.01299-19 PubMed 31578296