pLJM1-zeo-ORF24-3xFLAG
(Plasmid
#130959)
-
PurposeLentiviral vector for expression of KSHV ORF24 with a C-terminal 3xFLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130959 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLJM1
- Backbone size w/o insert (bp) 7151
- Total vector size (bp) 9407
-
Vector typeLentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF24
-
SpeciesKaposi's Sarcoma Associated Herpesvirus (HHV-8)
-
Insert Size (bp)2256
-
Entrez GeneORF24 (a.k.a. HHV8GK18_gp27)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ggatctctgctgtccctgtaataaacc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-zeo-ORF24-3xFLAG was a gift from Britt Glaunsinger (Addgene plasmid # 130959 ; http://n2t.net/addgene:130959 ; RRID:Addgene_130959) -
For your References section:
Conserved CxnC motifs in Kaposi's sarcoma-associated herpesvirus ORF66 are required for viral late gene expression and are essential for its interaction with ORF34. Didychuk AL, Castaneda AF, Kushnir LO, Huang CJ, Glaunsinger BA. J Virol. 2019 Oct 2. pii: JVI.01299-19. doi: 10.1128/JVI.01299-19. 10.1128/JVI.01299-19 PubMed 31578296