Skip to main content

MADR pDonor smFP-Myc (dark) WPRE
(Plasmid #130987)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130987 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MADR pDonor
  • Backbone size w/o insert (bp) 5572
  • Total vector size (bp) 6658
  • Vector type
    Mosaic analysis for dual recombinase-mediated cassette exchange (MADR) donor

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    smFP-Myc WPRE
  • Species
    Synthetic
  • Insert Size (bp)
    1086
  • Mutation
    "dark" variant with GGG fluorophore versus TYG in wildtype EGFP or "bright" variant
  • Promoter none (4x polyA to mitigate episomal expression)
  • Tag / Fusion Protein
    • Myc - 10 total Myc tags

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer MADR-MCSF (TCGACCTGCAGCCCAAGCTA)
  • 3′ sequencing primer WPRE-R (addgene)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    addgene Plasmid #59757

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MADR pDonor smFP-Myc (dark) WPRE was a gift from Joshua Breunig (Addgene plasmid # 130987 ; http://n2t.net/addgene:130987 ; RRID:Addgene_130987)
  • For your References section:

    Rapid Generation of Somatic Mouse Mosaics with Locus-Specific, Stably Integrated Transgenic Elements. Kim GB, Rincon Fernandez Pacheco D, Saxon D, Yang A, Sabet S, Dutra-Clarke M, Levy R, Watkins A, Park H, Abbasi Akhtar A, Linesch PW, Kobritz N, Chandra SS, Grausam K, Ayala-Sarmiento A, Molina J, Sedivakova K, Hoang K, Tsyporin J, Gareau DS, Filbin MG, Bannykh S, Santiskulvong C, Wang Y, Tang J, Suva ML, Chen B, Danielpour M, Breunig JJ. Cell. 2019 Sep 19;179(1):251-267.e24. doi: 10.1016/j.cell.2019.08.013. 10.1016/j.cell.2019.08.013 PubMed 31539496