Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-hSyn-ChRmine-mScarlet-WPRE
(Plasmid #130994)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130994 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChRmine
  • Species
    Tiarina fusus
  • GenBank ID
    MN194599
  • Promoter hSyn
  • Tag / Fusion Protein
    • mScarlet (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ccacgcgaggcgcgagatag
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-ChRmine-mScarlet-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 130994 ; http://n2t.net/addgene:130994 ; RRID:Addgene_130994)
  • For your References section:

    Cortical layer-specific critical dynamics triggering perception. Marshel JH, Kim YS, Machado TA, Quirin S, Benson B, Kadmon J, Raja C, Chibukhchyan A, Ramakrishnan C, Inoue M, Shane JC, McKnight DJ, Yoshizawa S, Kato HE, Ganguli S, Deisseroth K. Science. 2019 Aug 9;365(6453). pii: science.aaw5202. doi: 10.1126/science.aaw5202. Epub 2019 Jul 18. 10.1126/science.aaw5202 PubMed 31320556