pYJ12-PB-U6-ND1-acti-gRNA1
(Plasmid
#131056)
-
PurposeActivation of NeuroD1 via SAM system
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131056 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB-MS2-sgRNA
- Backbone size w/o insert (bp) 4131
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNeuroD1 activation gRNA1
-
gRNA/shRNA sequenceGCGGGGAGGAAGGAGGAGGGG
-
SpeciesH. sapiens (human)
-
Entrez GeneNEUROD1 (a.k.a. BETA2, BHF-1, MODY6, NEUROD, T2D, bHLHa3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYJ12-PB-U6-ND1-acti-gRNA1 was a gift from Xiaojun Lian (Addgene plasmid # 131056 ; http://n2t.net/addgene:131056 ; RRID:Addgene_131056)