Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA4/TO-ORF66 C355A-2xStrep
(Plasmid #131114)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131114 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5117
  • Total vector size (bp) 6404
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF66
  • Species
    Kaposi's Sarcoma Associated Herpesvirus (HHV-8)
  • Insert Size (bp)
    1287
  • Mutation
    ORF66 a.a. 1-429 (full-length); cysteine 355 mutated to alanine
  • Entrez Gene
    ORF66 (a.k.a. HHV8GK18_gp75)
  • Promoter CMV
  • Tag / Fusion Protein
    • 2xStrep (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4/TO-ORF66 C355A-2xStrep was a gift from Britt Glaunsinger (Addgene plasmid # 131114 ; http://n2t.net/addgene:131114 ; RRID:Addgene_131114)
  • For your References section:

    Conserved CxnC motifs in Kaposi's sarcoma-associated herpesvirus ORF66 are required for viral late gene expression and are essential for its interaction with ORF34. Didychuk AL, Castaneda AF, Kushnir LO, Huang CJ, Glaunsinger BA. J Virol. 2019 Oct 2. pii: JVI.01299-19. doi: 10.1128/JVI.01299-19. 10.1128/JVI.01299-19 PubMed 31578296