pcDNA4/TO-ORF66 C289A-2xStrep
(Plasmid
#131120)
-
PurposeExpresses KSHV ORF66 a.a. 1-429 (full length) C289A mutant with a C-terminal 2xStrep tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131120 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA4/TO
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 5117
- Total vector size (bp) 6404
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF66
-
SpeciesKaposi's Sarcoma Associated Herpesvirus (HHV-8)
-
Insert Size (bp)1287
-
MutationORF66 a.a. 1-429 (full-length); cysteine 289 mutated to alanine
-
Entrez GeneORF66 (a.k.a. HHV8GK18_gp75)
- Promoter CMV
-
Tag
/ Fusion Protein
- 2xStrep (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4/TO-ORF66 C289A-2xStrep was a gift from Britt Glaunsinger (Addgene plasmid # 131120 ; http://n2t.net/addgene:131120 ; RRID:Addgene_131120) -
For your References section:
Conserved CxnC motifs in Kaposi's sarcoma-associated herpesvirus ORF66 are required for viral late gene expression and are essential for its interaction with ORF34. Didychuk AL, Castaneda AF, Kushnir LO, Huang CJ, Glaunsinger BA. J Virol. 2019 Oct 2. pii: JVI.01299-19. doi: 10.1128/JVI.01299-19. 10.1128/JVI.01299-19 PubMed 31578296