Skip to main content
Addgene

pHD-dsRed-attP_dCrk_flankingHRs
(Plasmid #131141)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131141 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHD-dsRed-attP
  • Backbone size w/o insert (bp) 4098
  • Total vector size (bp) 5788
  • Vector type
    Cre/Lox, CRISPR ; Homology directed repair template
  • Selectable markers
    DsRed expression in the eye

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Crk Upstream Homology Region
  • Alt name
    Crk
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    815
  • Entrez Gene
    Crk (a.k.a. Dmel_CG1587, CG1587, CRK, D-CRK, D-Crk, DCrk, Dcrk, Dmel\CG1587, crk, dCRK, dCrk)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AarI (destroyed during cloning)
  • 3′ cloning site AarI (destroyed during cloning)
  • 5′ sequencing primer TTCGTTTCTCGGTTTTCACC
  • 3′ sequencing primer AAACCAGTGCAGACAATTCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Crk Downstream Homology Region
  • Alt name
    Crk
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1000
  • Entrez Gene
    Crk (a.k.a. Dmel_CG1587, CG1587, CRK, D-CRK, D-Crk, DCrk, Dcrk, Dmel\CG1587, crk, dCRK, dCrk)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer GTGCTCTCGGAACGTGGTAT
  • 3′ sequencing primer AGTGGCCGTGGCAAAAAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHD-dsRed-attP_dCrk_flankingHRs was a gift from Mark Peifer (Addgene plasmid # 131141 ; http://n2t.net/addgene:131141 ; RRID:Addgene_131141)
  • For your References section:

    The Crk adapter protein is essential for Drosophila embryogenesis, where it regulates multiple actin-dependent morphogenic events. Spracklen AJ, Thornton-Kolbe EM, Bonner AN, Florea A, Compton PJ, Fernandez-Gonzalez R, Peifer M. Mol Biol Cell. 2019 Jul 18:mbcE19050302. doi: 10.1091/mbc.E19-05-0302. 10.1091/mbc.E19-05-0302 PubMed 31318326