pHD-dsRed-attP_dCrk_flankingHRs
(Plasmid
#131141)
-
PurposeContains ~1kb homology regions flanking Drosophila crk locus. Used to make crk null mutant. Homology regions cloned into AarI and SapI sites of pHD-dsRed-attP (Harrison, O'Connor-Giles, Wildonger).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131141 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHD-dsRed-attP
- Backbone size w/o insert (bp) 4098
- Total vector size (bp) 5788
-
Vector typeCre/Lox, CRISPR ; Homology directed repair template
-
Selectable markersDsRed expression in the eye
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCrk Upstream Homology Region
-
Alt nameCrk
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)815
-
Entrez GeneCrk (a.k.a. Dmel_CG1587, CG1587, CRK, D-CRK, D-Crk, DCrk, Dcrk, Dmel\CG1587, crk, dCRK, dCrk)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AarI (destroyed during cloning)
- 3′ cloning site AarI (destroyed during cloning)
- 5′ sequencing primer TTCGTTTCTCGGTTTTCACC
- 3′ sequencing primer AAACCAGTGCAGACAATTCG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCrk Downstream Homology Region
-
Alt nameCrk
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1000
-
Entrez GeneCrk (a.k.a. Dmel_CG1587, CG1587, CRK, D-CRK, D-Crk, DCrk, Dcrk, Dmel\CG1587, crk, dCRK, dCrk)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer GTGCTCTCGGAACGTGGTAT
- 3′ sequencing primer AGTGGCCGTGGCAAAAAGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHD-dsRed-attP_dCrk_flankingHRs was a gift from Mark Peifer (Addgene plasmid # 131141 ; http://n2t.net/addgene:131141 ; RRID:Addgene_131141) -
For your References section:
The Crk adapter protein is essential for Drosophila embryogenesis, where it regulates multiple actin-dependent morphogenic events. Spracklen AJ, Thornton-Kolbe EM, Bonner AN, Florea A, Compton PJ, Fernandez-Gonzalez R, Peifer M. Mol Biol Cell. 2019 Jul 18:mbcE19050302. doi: 10.1091/mbc.E19-05-0302. 10.1091/mbc.E19-05-0302 PubMed 31318326