pCMV6-AN-DDK_WT POLI
(Plasmid
#131228)
-
PurposeExpression of WT DNA polymerase iota with an N-terminal FLAG tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV6-AN-DDK
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 5876
- Total vector size (bp) 8066
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNA polymerase iota
-
Alt namePOLI
-
Alt nameDNA polymerase iota isoform a (short)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2190
-
MutationCoding sequence has been codon optimised for expression in human cells
-
GenBank IDNM_001351632.2
-
Entrez GenePOLI (a.k.a. RAD30B, RAD3OB, eta2)
- Promoter CMV enhancer + CMV promoter
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-AN-DDK_WT POLI was a gift from Roger Woodgate (Addgene plasmid # 131228 ; http://n2t.net/addgene:131228 ; RRID:Addgene_131228) -
For your References section:
Ubiquitin mediates the physical and functional interaction between human DNA polymerases eta and iota. McIntyre J, Vidal AE, McLenigan MP, Bomar MG, Curti E, McDonald JP, Plosky BS, Ohashi E, Woodgate R. Nucleic Acids Res. 2013 Feb 1;41(3):1649-60. doi: 10.1093/nar/gks1277. Epub 2012 Dec 16. 10.1093/nar/gks1277 PubMed 23248005