Skip to main content

pCMV6-AN-DDK_WT POLI
(Plasmid #131228)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131228 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV6-AN-DDK
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 5876
  • Total vector size (bp) 8066
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNA polymerase iota
  • Alt name
    POLI
  • Alt name
    DNA polymerase iota isoform a (short)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2190
  • Mutation
    Coding sequence has been codon optimised for expression in human cells
  • GenBank ID
    NM_001351632.2
  • Entrez Gene
    POLI (a.k.a. RAD30B, RAD3OB, eta2)
  • Promoter CMV enhancer + CMV promoter
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsiSI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6-AN-DDK_WT POLI was a gift from Roger Woodgate (Addgene plasmid # 131228 ; http://n2t.net/addgene:131228 ; RRID:Addgene_131228)
  • For your References section:

    Ubiquitin mediates the physical and functional interaction between human DNA polymerases eta and iota. McIntyre J, Vidal AE, McLenigan MP, Bomar MG, Curti E, McDonald JP, Plosky BS, Ohashi E, Woodgate R. Nucleic Acids Res. 2013 Feb 1;41(3):1649-60. doi: 10.1093/nar/gks1277. Epub 2012 Dec 16. 10.1093/nar/gks1277 PubMed 23248005