Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EcNGsC-F307Y-pKK223
(Plasmid #131381)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131381 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKK223
  • Backbone size w/o insert (bp) 4577
  • Total vector size (bp) 5663
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EcNGsC MutY chimera F307Y
  • Alt name
    F307Y EcNGsC
  • Alt name
    F307Y
  • Species
    E. coli and Geobacillus stearothermophilus
  • Insert Size (bp)
    1086
  • Mutation
    Fusion of two MutY genes. Residues 1-225 are from E.coli MutY and residues 226-360 correspond with residues 231-365 of G.stearothermophilus MutY. Amino acid change F307Y in Gs MutY, corresponding with position 302 in the chimera MutY.
  • Promoter tac

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer UpTac - GTTTTTTGCGCCGACATCATAACGGTTC
  • 3′ sequencing primer TacTrm - GCTTCTGCGTTCTGATTTAATCTGTATCAGGCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EcNGsC-F307Y-pKK223 was a gift from Martin Horvath (Addgene plasmid # 131381 ; http://n2t.net/addgene:131381 ; RRID:Addgene_131381)
  • For your References section:

    Structural Basis for Finding OG Lesions and Avoiding Undamaged G by the DNA Glycosylase MutY. Russelburg LP, O'Shea Murray VL, Demir M, Knutsen KR, Sehgal SL, Cao S, David SS, Horvath MP. ACS Chem Biol. 2019 Dec 27. doi: 10.1021/acschembio.9b00639. 10.1021/acschembio.9b00639 PubMed 31829624