LMX1B-gRNA-C-del
(Plasmid
#131516)
-
PurposegRNA to delete a nucleation site near Lmx1b. Use with LMX1B-gRNA-N-del
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (PX458)
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48138)
- Backbone size w/o insert (bp) 9300
- Total vector size (bp) 9320
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLMX1B-gRNA-C-del
-
gRNA/shRNA sequenceGACCCATCTTGTGAGAGCGG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning) (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning) (destroyed during cloning)
- 5′ sequencing primer TTTATGGCGAGGCGGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LMX1B-gRNA-C-del was a gift from Danny Reinberg (Addgene plasmid # 131516 ; http://n2t.net/addgene:131516 ; RRID:Addgene_131516) -
For your References section:
Capturing the Onset of PRC2-Mediated Repressive Domain Formation. Oksuz O, Narendra V, Lee CH, Descostes N, LeRoy G, Raviram R, Blumenberg L, Karch K, Rocha PP, Garcia BA, Skok JA, Reinberg D. Mol Cell. 2018 Jun 21;70(6):1149-1162.e5. doi: 10.1016/j.molcel.2018.05.023. 10.1016/j.molcel.2018.05.023 PubMed 29932905