Skip to main content

LMX1B-gRNA-C-del
(Plasmid #131516)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131516 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138)
  • Backbone size w/o insert (bp) 9300
  • Total vector size (bp) 9320
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LMX1B-gRNA-C-del
  • gRNA/shRNA sequence
    GACCCATCTTGTGAGAGCGG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning) (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning) (destroyed during cloning)
  • 5′ sequencing primer TTTATGGCGAGGCGGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LMX1B-gRNA-C-del was a gift from Danny Reinberg (Addgene plasmid # 131516 ; http://n2t.net/addgene:131516 ; RRID:Addgene_131516)
  • For your References section:

    Capturing the Onset of PRC2-Mediated Repressive Domain Formation. Oksuz O, Narendra V, Lee CH, Descostes N, LeRoy G, Raviram R, Blumenberg L, Karch K, Rocha PP, Garcia BA, Skok JA, Reinberg D. Mol Cell. 2018 Jun 21;70(6):1149-1162.e5. doi: 10.1016/j.molcel.2018.05.023. 10.1016/j.molcel.2018.05.023 PubMed 29932905