AdMKP-3 S159AS197A
(Plasmid
#131523)
-
PurposeExpresses MKP-3 with S159A mutation and S197A mutation in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAd/CMV/V5-DEST
-
Backbone manufacturerInvitrogen (Life Technologies)
- Backbone size w/o insert (bp) 36686
- Total vector size (bp) 37832
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMitogen-activated protein kinase phosphatase 3
-
Alt nameMkp-3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1146
-
Mutationchanged Serine 159 to Alanine and Serine 197 to Alanine
-
GenBank IDNM_026268.3
-
Entrez GeneDusp6 (a.k.a. 1300019I03Rik, MKP-3, MKP3, PYST1)
- Promoter CMV
-
Tag
/ Fusion Protein
- No
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer T7 primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AdMKP-3 S159AS197A was a gift from Haiyan Xu (Addgene plasmid # 131523 ; http://n2t.net/addgene:131523 ; RRID:Addgene_131523) -
For your References section:
MEK/ERK pathway mediates insulin-promoted degradation of MKP-3 protein in liver cells. Feng B, Jiao P, Yang Z, Xu H. Mol Cell Endocrinol. 2012 Sep 25;361(1-2):116-23. doi: 10.1016/j.mce.2012.03.025. Epub 2012 Apr 12. 10.1016/j.mce.2012.03.025 PubMed 22521266