Ad-SNRK
              
              
                (Plasmid
                
                #131539)
              
            
            
            
          - 
            PurposeExpresses SNRK in mammalian cells
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepAd/CMV/V5-DEST
 - 
              Backbone manufacturerInvitrogen (Life Technologies)
 - Backbone size w/o insert (bp) 36686
 - Total vector size (bp) 38932
 - 
              Modifications to backboneNo
 - 
              Vector typeAdenoviral
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameSNF related kinase
 - 
                  Alt nameSNRK
 - 
                    SpeciesM. musculus (mouse)
 - 
                  Insert Size (bp)2246
 - 
                  MutationNo
 - 
                    GenBank IDNM_133741.2
 - 
                        Entrez GeneSnrk (a.k.a. 2010012F07Rik, AI448042, AW547029, E030034B15, R74830, mKIAA0096)
 - Promoter CMV
 - 
    
        Tag
        / Fusion Protein
    
- No
 
 
Cloning Information
- Cloning method Gateway Cloning
 - 5′ sequencing primer T7 primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
Ad-SNRK was a gift from Haiyan Xu (Addgene plasmid # 131539 ; http://n2t.net/addgene:131539 ; RRID:Addgene_131539) - 
                
For your References section:
Identification of sucrose non-fermenting-related kinase (SNRK) as a suppressor of adipocyte inflammation. Li Y, Nie Y, Helou Y, Ding G, Feng B, Xu G, Salomon A, Xu H. Diabetes. 2013 Jul;62(7):2396-409. doi: 10.2337/db12-1081. Epub 2013 Mar 21. 10.2337/db12-1081 PubMed 23520131