Ad-EEF1D-S133E
(Plasmid
#131577)
-
PurposeExpresses EEF1D with S133E mutation in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAd/CMV/V5-DEST
-
Backbone manufacturerInvitrogen (Life Technologies)
- Backbone size w/o insert (bp) 36686
- Total vector size (bp) 38630
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEukaryotic translation elongation factor 1 delta
-
SpeciesH. sapiens (human)
-
Insert Size (bp)873
-
Mutationchanged Serine 133 to Glutamic acid
-
GenBank IDNM_001130055.3
-
Entrez GeneEEF1D (a.k.a. EF-1D, EF1D, FP1047)
- Promoter CMV
-
Tag
/ Fusion Protein
- No
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer T7 primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ad-EEF1D-S133E was a gift from Haiyan Xu (Addgene plasmid # 131577 ; http://n2t.net/addgene:131577 ; RRID:Addgene_131577)