Skip to main content

Opie2-PuroR[dsxM]
(Plasmid #131616)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131616 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PiggyBac
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 13704
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PuroR[dsxM]
  • Alt name
    PuroR with encoded male-specific intron from D. melanogaster Dsx gene.
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    5680
  • Entrez Gene
    dsx (a.k.a. Dmel_CG11094, CG11094, DSX, DSXF, DSXM, Dmdsx, Dmel\CG11094, Dsx, Hr, dsxF, dsxM, ix-62c)
  • Promoter Opie2

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcaacctgtctctggtgatgGTAAGTCTG
  • 3′ sequencing primer TCGAGGTCGAagatctctcaggcaccg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dsRed
  • Species
    Synthetic
  • Promoter hr5Ie1

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer actggcggcgacaagatcgtgaacaaccaagtg
  • 3′ sequencing primer gcggccgctacaggaacaggtggtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Opie2-PuroR[dsxM] was a gift from Omar Akbari (Addgene plasmid # 131616 ; http://n2t.net/addgene:131616 ; RRID:Addgene_131616)
  • For your References section:

    A drug-inducible sex-separation technique for insects. Kandul NP, Liu J, Hsu AD, Hay BA, Akbari OS. Nat Commun. 2020 Apr 30;11(1):2106. doi: 10.1038/s41467-020-16020-2. 10.1038/s41467-020-16020-2 PubMed 32355156