Skip to main content
Addgene

pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
(Plasmid #131684)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131684 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pOTTC1553
  • Backbone manufacturer
    NIDA GEVVC
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    EGFP-KASH
  • Alt name
    Green Fluorescent Protein fused to KASH nuclear envelope localization domain
  • Species
    Synthetic
  • Promoter EF1a
  • Tag / Fusion Protein
    • KASH (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    SpCas9 sgRNA vs mouse GRID1
  • Alt name
    GAACCCTAGCCCTGACGGCG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Promoter mU6-LSL (Cre dependent)

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH was a gift from Christopher Richie (Addgene plasmid # 131684 ; http://n2t.net/addgene:131684 ; RRID:Addgene_131684)
  • For your References section:

    Delta glutamate receptor conductance drives excitation of mouse dorsal raphe neurons. Gantz SC, Moussawi K, Hake HS. Elife. 2020 Apr 1;9. pii: 56054. doi: 10.7554/eLife.56054. 10.7554/eLife.56054 PubMed 32234214