pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
(Plasmid
#131684)
-
PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepOTTC1553
-
Backbone manufacturerNIDA GEVVC
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameEGFP-KASH
-
Alt nameGreen Fluorescent Protein fused to KASH nuclear envelope localization domain
-
SpeciesSynthetic
- Promoter EF1a
-
Tag
/ Fusion Protein
- KASH (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSpCas9 sgRNA vs mouse GRID1
-
Alt nameGAACCCTAGCCCTGACGGCG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
- Promoter mU6-LSL (Cre dependent)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCGCACAGACTTGTGGGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH was a gift from Christopher Richie (Addgene plasmid # 131684 ; http://n2t.net/addgene:131684 ; RRID:Addgene_131684) -
For your References section:
Delta glutamate receptor conductance drives excitation of mouse dorsal raphe neurons. Gantz SC, Moussawi K, Hake HS. Elife. 2020 Apr 1;9. pii: 56054. doi: 10.7554/eLife.56054. 10.7554/eLife.56054 PubMed 32234214