pFDH
(Plasmid #131706)

• Purpose: Express constitutively an NAD-dependent formate dehydrogenase from Pseudomonas sp. 101 in E. coli
• Depositing Lab: Ron Milo
• Publication: Gleizer et al Cell. 2019 Nov 27;179(6):1255-1263.e12. doi: 10.1016/j.cell.2019.11.009.

Backbone

• Vector backbone: pZE21-MCS
• Backbone manufacturer: Expressys
• Backbone size w/o insert (bp): 1799
• Total vector size (bp): 3023
• Modifications to backbone: SmR gene instead of KanR
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: formate dehydrogenase
• Alt name: fdh
• Species: Pseudomonas sp. 101
• Insert Size (bp): 1224
• GenBank ID: P33160
• Tag / Fusion Protein:
  • his-tag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TCTCGAGACCTATTGACAAT
• 3′ sequencing primer: TCACCGACAAACAACAGATA

Resource Information

• Supplemental Documents:
  • pFDH.gb
• A portion of this plasmid was derived from a plasmid made by: Dr. Yehudit Zohar, Weizmann Institute of Science, Rehovot, Israel

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry