MADR pDonor TagBFP2-V5-HRAS G12V WPRE RCE
(Plasmid
#131730)
-
PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic Hras G12V with a TagBFP2 fusion compatible with RCE:loxP mouse strain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMADR pdonor
-
Backbone manufacturerBreunig Lab
- Total vector size (bp) 6483
-
Modifications to backboneLoxP site orientation modified to be compatible with Rosa26 Cag EGFP (i.e. RCE:LoxP) mouse line from the laboratory of Gord Fishell (https://www.jax.org/strain/010701).
-
Vector typeMammalian Expression, Cre/Lox, Synthetic Biology ; Mosaic analysis for dual recombinase-mediated cassette exchange (MADR) donor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagBFP2-V5-HRAS G12V
-
SpeciesH. sapiens (human); Entacmaea quadricolor (TagBFP)
-
MutationG12V
-
Entrez GeneHRAS (a.k.a. C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV, HRAS1, RASH1, p21ras)
- Promoter none (4x polyA to mitigate episomal expression)
-
Tag
/ Fusion Protein
- TagBFP2-V5 tag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer MADR-MCSF (TCGACCTGCAGCCCAAGCTA)
- 3′ sequencing primer WPRE-R (addgene) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutated TagBFP to TagBFP2 (I174A substitution)
Compatible with RCE:loxP mouse strain (https://www.jax.org/strain/010701) but not with mt/mg strain. Can be used as a negative control for MADR insertion in mt/mg line.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MADR pDonor TagBFP2-V5-HRAS G12V WPRE RCE was a gift from Joshua Breunig (Addgene plasmid # 131730 ; http://n2t.net/addgene:131730 ; RRID:Addgene_131730) -
For your References section:
Rapid Generation of Somatic Mouse Mosaics with Locus-Specific, Stably Integrated Transgenic Elements. Kim GB, Rincon Fernandez Pacheco D, Saxon D, Yang A, Sabet S, Dutra-Clarke M, Levy R, Watkins A, Park H, Abbasi Akhtar A, Linesch PW, Kobritz N, Chandra SS, Grausam K, Ayala-Sarmiento A, Molina J, Sedivakova K, Hoang K, Tsyporin J, Gareau DS, Filbin MG, Bannykh S, Santiskulvong C, Wang Y, Tang J, Suva ML, Chen B, Danielpour M, Breunig JJ. Cell. 2019 Sep 19;179(1):251-267.e24. doi: 10.1016/j.cell.2019.08.013. 10.1016/j.cell.2019.08.013 PubMed 31539496