Skip to main content

pFA0055
(Plasmid #131774)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131774 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pML107 (addgene #67639)
  • Backbone size w/o insert (bp) 12364
  • Total vector size (bp) 12384
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    20mer CASS5a guide (gCASS5a) and 5' sgRNA
  • gRNA/shRNA sequence
    ACGGATCCCCGGGTTAATTA
  • Species
    S. cerevisiae (budding yeast)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BclI (not destroyed)
  • 3′ cloning site SwaI (destroyed during cloning)
  • 5′ sequencing primer M13 rev or T3
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFA0055 was a gift from Frank Albert (Addgene plasmid # 131774 ; http://n2t.net/addgene:131774 ; RRID:Addgene_131774)
  • For your References section:

    DNA variants affecting the expression of numerous genes in trans have diverse mechanisms of action and evolutionary histories. Lutz S, Brion C, Kliebhan M, Albert FW. PLoS Genet. 2019 Nov 18;15(11):e1008375. doi: 10.1371/journal.pgen.1008375. eCollection 2019 Nov. 10.1371/journal.pgen.1008375 PubMed 31738765