pAAV-Ef1a-Con/Fon oG
(Plasmid #131778)

• Purpose: INTRSECT 2.0
• Depositing Lab: Karl Deisseroth
• Publication: Hafner et al Cell Rep. 2019 Sep 24;28(13):3450-3461.e8. doi: 10.1016/j.celrep.2019.08.064.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5571
• Total vector size (bp): 7488
• Modifications to backbone: none
• Vector type: Mammalian Expression, AAV ; INTRSECT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can also use Stbl3 cells
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rabies glycoprotein - oG
• Species: Synthetic
• Insert Size (bp): 1917
• Promoter: Ef1a
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GTTAGGCCAGCTTGGCACTTG
• 3′ sequencing primer: GAATACCAGTCAATCTTTCAC

Resource Information

• Supplemental Documents:
  • pAAV-EF1a ConFon oG.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry