pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG
(Plasmid #85225)

• Purpose: Expresses TVA, EGFP, and optimized Rabies G (oG) protein in a FLEX cassette
• Depositing Lab: John Naughton
• Publication: Salk GT3 Core Rabies Plasmids (unpublished)

Backbone

• Vector backbone: pAAV-syn-FLEX-splitTVA-eGFP-B19G IW
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Optimized G Protein
• Alt name: oG
• Species: Synthetic
• Insert Size (bp): 1575
• Promoter: hSyn

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: AGTCGTGTCGTGCCTGAGAG
• 3′ sequencing primer: CGGGATCACTCTCGGCATGG

Gene/Insert 2

• Gene/Insert name: Enhanced GFP
• Alt name: EGFP
• Species: Synthetic
• Insert Size (bp): 717

Gene/Insert 3

• Gene/Insert name: TVA
• Species: G. gallus (chicken)
• Insert Size (bp): 468

Resource Information

• Supplemental Documents:
  • pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG.gb
• A portion of this plasmid was derived from a plasmid made by: Optimized G protein was provide by Euiseok Kim and Ed Callaway at the Salk Institute.
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry