-
PurposepAAV vector to express oG (optimized Glycoprotein) in a Cre-dependent manner
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CAG-FLEX
-
Backbone manufacturerE. Boyden lab (MIT)
- Backbone size w/o insert (bp) 2879
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameoG (optimized Glycoprotein)
-
Speciesglycoprotein for rabies virus SAD B19
-
Mutationchimeric glycoprotein
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-FLEX-oG-WPRE-SV40pA was a gift from Edward Callaway (Addgene plasmid # 74292 ; http://n2t.net/addgene:74292 ; RRID:Addgene_74292) -
For your References section:
Improved Monosynaptic Neural Circuit Tracing Using Engineered Rabies Virus Glycoproteins. Kim EJ, Jacobs MW, Ito-Cole T, Callaway EM. Cell Reports 2016 10.1016/j.celrep.2016.03.067