Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-CAG-fDIO-oG-WPRE-SV40pA
(Plasmid #74291)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74291 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Currently unavailable outside the U.S.

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-CAG-fDIO
  • Backbone manufacturer
    K. Deisseroth lab (Stanford)
  • Backbone size w/o insert (bp) 2879
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    oG (optimized Glycoprotein)
  • Species
    glycoprotein for rabies virus SAD B19
  • Mutation
    chimeric glycoprotein
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-fDIO-oG-WPRE-SV40pA was a gift from Edward Callaway (Addgene plasmid # 74291 ; http://n2t.net/addgene:74291 ; RRID:Addgene_74291)
  • For your References section:

    Improved Monosynaptic Neural Circuit Tracing Using Engineered Rabies Virus Glycoproteins. Kim EJ, Jacobs MW, Ito-Cole T, Callaway EM. Cell Reports 2016 10.1016/j.celrep.2016.03.067