-
PurposeExpresses splitTVA-EGFP-B19G
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 52473 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | ||
AAV1 | 52473-AAV1 | 100 µL at titer ≥ 1×10¹³ vg/mL and Plasmid. |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4436
- Total vector size (bp) 7325
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3 at 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTVA-P2A-EGFP-P2A-B19G
-
SpeciesSynthetic
-
Insert Size (bp)2889
- Promoter Synapsin-1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGCGTATGAGTGCAAG TGTGTTGCGTAGGTTCTG TTGAGTTTGCATGCTCC TCGTGTAAATAGGGAATTTC
- 3′ sequencing primer cagcgtatccacatagcg (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
Alternative plasmid name: pAAV-synP-FLEX-sTpEpB
Information for AAV1 (Catalog # 52473-AAV1) ( Back to top )
Purpose
Ready-to-use AAV1 particles produced from pAAV-synP-FLEX-splitTVA-EGFP-B19G (#52473). In addition to the viral particles, you will also receive purified pAAV-synP-FLEX-splitTVA-EGFP-B19G plasmid DNA.
Helper virus for monosynaptic tracing with rabies virus. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene EGFP (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Dr. Wickersham has tested this lot#v14715 (2.4 × 10^13 GC∕mL) and he recommends a 1:10 dilution.
When selecting what system to use, keep in mind that the sTpEptTA (Addgene#100798) + TRE (Addgene# 100799) combination allows reduction of background infection by Rabies Virus in wild-type mice to acceptably few cells while still allowing nice amounts of transsynaptic spread in Cre+ mice. Note that EGFP can be seen only with immunostaining at these dilutions. This vector (Addgene #52473) is simpler because you only need to inject a single AAV but forces a less optimal compromise: more background or less transsynaptic spread.
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.6% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-synP-FLEX-splitTVA-EGFP-B19G was a gift from Ian Wickersham (Addgene plasmid # 52473 ; http://n2t.net/addgene:52473 ; RRID:Addgene_52473)
For viral preps, please replace (Addgene plasmid # 52473) in the above sentence with: (Addgene viral prep # 52473-AAV1)
-
For your References section:
Cell type-specific genetic and optogenetic tools reveal hippocampal CA2 circuits. Kohara K, Pignatelli M, Rivest AJ, Jung HY, Kitamura T, Suh J, Frank D, Kajikawa K, Mise N, Obata Y, Wickersham IR, Tonegawa S. Nat Neurosci. 2014 Feb;17(2):269-79. doi: 10.1038/nn.3614. Epub 2013 Dec 15. 10.1038/nn.3614 PubMed 24336151