-
PurposeINTRSECT 2.0
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131779 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4861
- Total vector size (bp) 6461
-
Modifications to backbonenone
-
Vector typeMammalian Expression, AAV ; INTRSECT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3 Cells can also be used for the transformation
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTVA-mCherry
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)1600
- Promoter nEF
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer GTTTAAAGCTCAGGTCGAGA
- 3′ sequencing primer GAATACCAGTCAATCTTTCAC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-nEF-Con/Fon TVA-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 131779 ; http://n2t.net/addgene:131779 ; RRID:Addgene_131779) -
For your References section:
Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs. Hafner G, Witte M, Guy J, Subhashini N, Fenno LE, Ramakrishnan C, Kim YS, Deisseroth K, Callaway EM, Oberhuber M, Conzelmann KK, Staiger JF. Cell Rep. 2019 Sep 24;28(13):3450-3461.e8. doi: 10.1016/j.celrep.2019.08.064. 10.1016/j.celrep.2019.08.064 PubMed 31553913