Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-nEF-Con/Fon TVA-mCherry
(Plasmid #131779)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131779 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4861
  • Total vector size (bp) 6461
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression, AAV ; INTRSECT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3 Cells can also be used for the transformation
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TVA-mCherry
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    1600
  • Promoter nEF
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer GTTTAAAGCTCAGGTCGAGA
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-nEF-Con/Fon TVA-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 131779 ; http://n2t.net/addgene:131779 ; RRID:Addgene_131779)
  • For your References section:

    Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs. Hafner G, Witte M, Guy J, Subhashini N, Fenno LE, Ramakrishnan C, Kim YS, Deisseroth K, Callaway EM, Oberhuber M, Conzelmann KK, Staiger JF. Cell Rep. 2019 Sep 24;28(13):3450-3461.e8. doi: 10.1016/j.celrep.2019.08.064. 10.1016/j.celrep.2019.08.064 PubMed 31553913