Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-nEF-Coff/Fon DREADD Gi-mCherry
(Plasmid #177669)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177669 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4591
  • Total vector size (bp) 7487
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox ; INTRSECT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DREADD Gi-mCherry
  • Alt name
    hM4Gi-mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    2882
  • Promoter nEF
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTTTAAAGCTCAGGTCGAGA
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-nEF-Coff/Fon DREADD Gi-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 177669 ; http://n2t.net/addgene:177669 ; RRID:Addgene_177669)
  • For your References section:

    A functional cellular framework for sex and estrous cycle-dependent gene expression and behavior. Knoedler JR, Inoue S, Bayless DW, Yang T, Tantry A, Davis CH, Leung NY, Parthasarathy S, Wang G, Alvarado M, Rizvi AH, Fenno LE, Ramakrishnan C, Deisseroth K, Shah NM. Cell. 2022 Feb 17;185(4):654-671.e22. doi: 10.1016/j.cell.2021.12.031. Epub 2022 Jan 21. 10.1016/j.cell.2021.12.031 PubMed 35065713