pJH1922
(Plasmid
#132361)
-
PurposePrgef-1 INS-1::GFP unc-54 3' UTR C.elegans pan-neural expression of INS-1::GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBSK
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 8291
- Total vector size (bp) 9538
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameINS-1
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1236
-
Entrez Geneins-1 (a.k.a. CELE_F13B12.5)
- Promoter Prgef-1
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer atgtactggtttcgtcaagtttacag
- 3′ sequencing primer ggatccccattatcgtcctgattg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH1922 was a gift from Mei Zhen (Addgene plasmid # 132361 ; http://n2t.net/addgene:132361 ; RRID:Addgene_132361) -
For your References section:
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication. Hung WL, Wang Y, Chitturi J, Zhen M. Development. 2014 Apr;141(8):1767-79. doi: 10.1242/dev.103846. Epub 2014 Mar 26. 10.1242/dev.103846 PubMed 24671950