Skip to main content
Addgene

pCW57.1-GFP_mmu-miR-292b-3p_sponge
(Plasmid #132622)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132622 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW57-GFP-2A-MCS
  • Backbone manufacturer
    Adam Karpf Lab (addgene#: 71783)
  • Backbone size w/o insert (bp) 8405
  • Modifications to backbone
    cloning method: AgeI and BamHI restriction on pCW57.1-GFP, insert design with compatible restriction enzyme sites. The insert contains a stop codon, the sponge design and a polyA signal. An additional restriction enzyme site, PacI, is introduced between the sponge design and polyA signal to facilitate efficient generation of alternative sponge designs.
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    stop codon, mmu-miR-292b-3p sponge sequence and polyA signal
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    375
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer GAACGGACGTGAAGAATGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1-GFP_mmu-miR-292b-3p_sponge was a gift from Constance Ciaudo (Addgene plasmid # 132622 ; http://n2t.net/addgene:132622 ; RRID:Addgene_132622)