pCW57.1-RFP_mmu-miR-292b-3p_sponge
(Plasmid
#132623)
-
PurposeExpresses a TurboRFP transcript with test microRNA sponge for mmu-miR-292b-3p as 3'UTR; serves as template for other microRNA sponges
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57-RFP-P2A-MCS (Neo)
-
Backbone manufacturerAdam Karpf Lab (addgene#: 89182)
- Backbone size w/o insert (bp) 8636
-
Modifications to backbonecloning method: AgeI and BamHI restriction on pCW57.1-RFP, insert design with compatible restriction enzyme sites. The insert contains a stop codon, the sponge design and a polyA signal. An additional restriction enzyme site, PacI, is introduced between the sponge design and polyA signal to facilitate efficient generation of alternative sponge designs.
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namestop codon, mmu-miR-292b-3p sponge sequence and polyA signal
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)184
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer unknown
- 3′ sequencing primer GAACGGACGTGAAGAATGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1-RFP_mmu-miR-292b-3p_sponge was a gift from Constance Ciaudo (Addgene plasmid # 132623 ; http://n2t.net/addgene:132623 ; RRID:Addgene_132623)