pCW57.1-GFP_mmu-miR-16-5p_sponge
(Plasmid
#132624)
-
PurposeExpresses a TurboGFP transcript with microRNA sponge for mmu-miR-16-5p as 3'UTR
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCW57-GFP-2A-MCS
-
Backbone manufacturerAdam Karpf Lab (addgene#: 71783)
- Backbone size w/o insert (bp) 8405
-
Modifications to backboneCloning performed in 2 steps: 1) Generation of pCW57.1-GFP_mmu-miR-292b-3p_sponge plasmid by AgeI and BamHI restriction on pCW57.1-GFP and cloning of preparation insert containing a stop codon, a sponge design and polyA signal, separated by a PacI restriction enzyme site 2) AgeI and PacI restriction on the newly generated plasmid and insertion of orderded oligos.
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namestop codon, mmu-miR-16-5p sponge sequence and polyA signal
-
SpeciesM. musculus (mouse); Mammals
-
Insert Size (bp)459
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer unknown
- 3′ sequencing primer GAACGGACGTGAAGAATGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1-GFP_mmu-miR-16-5p_sponge was a gift from Constance Ciaudo (Addgene plasmid # 132624 ; http://n2t.net/addgene:132624 ; RRID:Addgene_132624)