pMini-CAAGs::RFP-DR48
(Plasmid
#132640)
-
PurposeFluorescent reporter to quantify elicitation of the strand annealing mediated repair pathway
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepkTol2C-EGFP
-
Backbone manufacturerKarl Clark
- Backbone size w/o insert (bp) 3711
- Total vector size (bp) 4529
-
Modifications to backboneRemoved EGFP Inserted mRFP Inserted Kozak Sequence
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRFP
-
Alt namemonomeric derviavtive of Red Fluorescent Protein
-
Alt nameRFP
-
SpeciesEntacmaea quadricolor
-
Insert Size (bp)804
-
MutationContains a 92bp insertion interrupting the open reading frame
- Promoter Chicken B-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer gcaacgtgctggttattgtg
- 3′ sequencing primer aaaAGATCTtcaattaagtttgtgccccagt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe broken RFP insert was derived from Jeff Essner's lab at Iowa State who is the co-corresponding author on the manuscript this construct is from. The broken RFP was used to establish a stable transgenic zebrafish line and the broken RFP was adapted for this plasmid such that it can be used in cell systems.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct contains Tol2 ITRs and can be used to establish a stable cell line via Tol2 transposition.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMini-CAAGs::RFP-DR48 was a gift from Stephen Ekker (Addgene plasmid # 132640 ; http://n2t.net/addgene:132640 ; RRID:Addgene_132640) -
For your References section:
Expanding the CRISPR Toolbox with ErCas12a in Zebrafish and Human Cells. Wierson WA, Simone BW, WareJoncas Z, Mann C, Welker JM, Kar B, Emch MJ, Friedberg I, Gendron WAC, Barry MA, Clark KJ, Dobbs DL, McGrail MA, Ekker SC, Essner JJ. CRISPR J. 2019 Dec;2(6):417-433. doi: 10.1089/crispr.2019.0026. Epub 2019 Nov 19. 10.1089/crispr.2019.0026 PubMed 31742435