Skip to main content

pKM197
(Plasmid #132665)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132665 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 132665-D50 50 μg of DNA in Tris buffer $495
DNA 132665-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pJS116
  • Backbone size w/o insert (bp) 6324
  • Modifications to backbone
    Addition of Cas9 (codon optimized for C. difficile expression), tetR, region of homology for pyrE deletion, gRNA, gdh promoter
  • Vector type
    E. coli - C. difficile shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Upstream & Downstream pyrE deletion region
  • Species
    C. difficile
  • Insert Size (bp)
    2000

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tttataaaatagttttatctacaatttttttatcaggaaacagcta
  • 3′ sequencing primer CTGCAAATGCAGGCTTCTTATTTTTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM197 was a gift from Joseph Sorg (Addgene plasmid # 132665 ; http://n2t.net/addgene:132665 ; RRID:Addgene_132665)
  • For your References section:

    Factors and Conditions That Impact Electroporation of Clostridioides difficile Strains. Bhattacharjee D, Sorg JA. mSphere. 2020 Mar 4;5(2):e00941-19. doi: 10.1128/mSphere.00941-19. 10.1128/mSphere.00941-19 PubMed 32132157