pKM126
(Plasmid
#105134)
-
PurposeClostridium difficile CRISPR-cas9 mutagenesis plasmid Tn916 oriT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJS116
- Backbone size w/o insert (bp) 6324
-
Modifications to backboneAddition of Cas9 (codon optimized for C. difficile expression), tetR, region of homology for pyrE deletion, gRNA, gdh promoter
-
Vector typeE. coli - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameUpstream & Downstream pyrE deletion region
-
SpeciesC. difficile
-
Insert Size (bp)2000
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer caggaaacagctatgacc
- 3′ sequencing primer tctgcaggcctcgag (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametetR
-
Insert Size (bp)624
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ctcgaggcctgcaga
- 3′ sequencing primer caatgatataatgtcaacaaaaaggagga (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4107
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttgatcgtagcgttaacagatc
- 3′ sequencing primer tgtaaaacgacggccagt (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namegRNA
-
Insert Size (bp)140
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaactataaaaaaaattgaagacatacaacagac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM126 was a gift from Joseph Sorg (Addgene plasmid # 105134 ; http://n2t.net/addgene:105134 ; RRID:Addgene_105134) -
For your References section:
Using CRISPR-Cas9-mediated genome editing to generate C. difficile mutants defective in selenoproteins synthesis. McAllister KN, Bouillaut L, Kahn JN, Self WT, Sorg JA. Sci Rep. 2017 Nov 7;7(1):14672. doi: 10.1038/s41598-017-15236-5. 10.1038/s41598-017-15236-5 [pii] PubMed 29116155