pKM197
(Plasmid
#132665)
-
PurposepyrE-targeted CRISPR-Cas9 control plasmid. Cas9 expression is controlled by the xylR promoter and results in improved conjugation efficiency. Induction with xylose results in a pyrE mutant.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 132665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJS116
- Backbone size w/o insert (bp) 6324
-
Modifications to backboneAddition of Cas9 (codon optimized for C. difficile expression), tetR, region of homology for pyrE deletion, gRNA, gdh promoter
-
Vector typeE. coli - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUpstream & Downstream pyrE deletion region
-
SpeciesC. difficile
-
Insert Size (bp)2000
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tttataaaatagttttatctacaatttttttatcaggaaacagcta
- 3′ sequencing primer CTGCAAATGCAGGCTTCTTATTTTTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM197 was a gift from Joseph Sorg (Addgene plasmid # 132665 ; http://n2t.net/addgene:132665 ; RRID:Addgene_132665) -
For your References section:
Factors and Conditions That Impact Electroporation of Clostridioides difficile Strains. Bhattacharjee D, Sorg JA. mSphere. 2020 Mar 4;5(2):e00941-19. doi: 10.1128/mSphere.00941-19. 10.1128/mSphere.00941-19 PubMed 32132157