Skip to main content
Addgene

pCMJJ4-FOXO1-IRES-Thy1.1
(Plasmid #132702)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132702 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMJJ4
  • Backbone size w/o insert (bp) 9900
  • Total vector size (bp) 11900
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FOXO1
  • Alt name
    forkhead box O1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1900
  • GenBank ID
    NM_002015
  • Entrez Gene
    FOXO1 (a.k.a. FKH1, FKHR, FOXO1A)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GCTCGGCGGGCTGGAAGAA
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    FOXO1 gene obtained from Origene (Cat.# RC200477). The pCMJJ4 was a gift from Joshy Jacob (Emory University), which contains the Thy1.1 insert. Cloning was performed by Oskar Laur at the Emory Integrated Genomics Core.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

FOXO1 contains a A511V mismatch that has not been found to have an impact in functional assays.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMJJ4-FOXO1-IRES-Thy1.1 was a gift from Mandy Ford (Addgene plasmid # 132702 ; http://n2t.net/addgene:132702 ; RRID:Addgene_132702)

  • For your References section:

    CD28-Dependent CTLA-4 Expression Fine-Tunes the Activation of Human Th17 Cells. Krummey SM, Hartigan CR, Liu D, Ford ML. iScience. 2020 Apr 24;23(4):100912. doi: 10.1016/j.isci.2020.100912. Epub 2020 Feb 14. 10.1016/j.isci.2020.100912 PubMed 32203908
Related items: