Skip to main content

pPRIME-CMV-GFP-shCrh1
(Plasmid #132709)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132709 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPRIME-CMV-GFP-recipient
  • Backbone manufacturer
    Addgene Plasmid #11657
  • Backbone size w/o insert (bp) 8491
  • Total vector size (bp) 8608
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    shCrh(1)
  • Alt name
    small hairpin RNA targeting the 3’-untranslated regions (UTR) of rat proCrh
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    117
  • GenBank ID
    NM_031019
  • Entrez Gene
    Crh (a.k.a. CRF)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCTTGTAGTTGCCGTCGTC
  • 3′ sequencing primer GCTGAACGGTCTGGTTATAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPRIME-CMV-GFP-shCrh1 was a gift from Robert Messing (Addgene plasmid # 132709 ; http://n2t.net/addgene:132709 ; RRID:Addgene_132709)
  • For your References section:

    Dissecting the Roles of GABA and Neuropeptides from Rat Central Amygdala CRF Neurons in Anxiety and Fear Learning. Pomrenze MB, Giovanetti SM, Maiya R, Gordon AG, Kreeger LJ, Messing RO. Cell Rep. 2019 Oct 1;29(1):13-21.e4. doi: 10.1016/j.celrep.2019.08.083. 10.1016/j.celrep.2019.08.083 PubMed 31577943