pPRIME-CMV-GFP-shNts2
(Plasmid #132714)

• Purpose: Encodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Nts
• Depositing Lab: Robert Messing
• Publication: Pomrenze et al Cell Rep. 2019 Oct 1;29(1):13-21.e4. doi: 10.1016/j.celrep.2019.08.083.

Backbone

• Vector backbone: pPRIME-CMV-GFP-recipient
• Backbone manufacturer: Addgene Plasmid #11657
• Backbone size w/o insert (bp): 8491
• Total vector size (bp): 8608
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: shNts(2)
• Alt name: small hairpin RNA targeting the 3’-untranslated regions (UTR) of rat proNeurotensin
• Species: R. norvegicus (rat)
• GenBank ID: NM_001102381
• Entrez Gene: Nts
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TCTTGTAGTTGCCGTCGTC
• 3′ sequencing primer: GCTGAACGGTCTGGTTATAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry